ACCGCTGGGG TTCCATCCCACTTCTGCACC TGCCATCTGCTGGGAAAACA TGGCAGGCATGGGACATAAA GTAGAGCTCACCAAGGGCAG GGTACGCTTGGGTACTGTCC ACATGTCCCAAGCCATCCAG ACAATCTGCCACAGCGTCAT AACGCAGCTCAGTAACAGTC2.9. Western Blot

ACCGCTGGGG TTCCATCCCACTTCTGCACC TGCCATCTGCTGGGAAAACA TGGCAGGCATGGGACATAAA GTAGAGCTCACCAAGGGCAG GGTACGCTTGGGTACTGTCC ACATGTCCCAAGCCATCCAG ACAATCTGCCACAGCGTCAT AACGCAGCTCAGTAACAGTC2.9. Western Blot Analysis The total protein was collected in the cells at distinctive occasions working with RIPA Buffer (Beyotime Biotechnology, Shanghai,…

By utilizing the following primers: 5-TTTTAA GGGCCTCCTGGGATT-3, 5-GGCTCTGAAGCCAGA AACTTACTG-3 (Tlr3 IRF-EBy using the following primers:

By utilizing the following primers: 5-TTTTAA GGGCCTCCTGGGATT-3, 5-GGCTCTGAAGCCAGA AACTTACTG-3 (Tlr3 IRF-EBy using the following primers: 5-TTTTAA GGGCCTCCTGGGATT-3, 5-GGCTCTGAAGCCAGA AACTTACTG-3 (Tlr3 IRF-E); 5-CAGACATGGTAG CTCATATCTTTAATCC-3, 5-AGCCATATCTGGCCT GGAAA-3 (Tlr3 intron three); and 5-CTCCACTCACGG…